SimpleSearch - Line and FST details


Line specific information

 
Line ID 588D06
Vector Used pGABI1
Line Availability available as T3 set from NASC (N456394)
Segregation Analysis 50:34:27
Confirmed for Hit At2g04890
Parent of DUPLO pair none
Parent of pair(s) 3021

Gene hit At2g04890

 
Sequence (A. th genome BLAST matches underlined)
>44-K021380-022-588-D06-8409
AAGCCATTACAATTGAATATATCCTGAGACCAAGATTCGGTCCATCCAACCAAGGTATGG
GATCCTCCCTATAGTGAG
GenBank Accession BX655288 [GenBank]
Graphic View Graphic view of gene At2g04890
Predicted Position of Insertion Chr2:1720593 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) F28I8
Hit Gene Code At2g04890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SCARECROW-like 21
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37