SimpleSearch - Line and FST details


Line specific information

 
Line ID 588F04
Vector Used pGABI1
Line Availability available as T3 set from NASC (N456416)
Segregation Analysis 50:45:31
Confirmed for Hit At1g07900
Parent of DUPLO pair 12317
Parent of pair(s) none

Gene hit At1g07900

 
Sequence (A. th genome BLAST matches underlined)
>30-K021380-022-588-F04-8409
AGCCATAGTTTTGCATCATCTATATCATTAAATAAAATCGGGTCTTTCTTAATGTAATTC
TTTCTAAGAACTAAAGAGCTTATAGCTTATTACACCAATAGATATATAGATAATTTAGGT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession BX655319 [GenBank]
Graphic View Graphic view of gene At1g07900
Predicted Position of Insertion Chr1:2442966 - go to primer design
BLAST e Value 9e-44
Hit Clone Code (BAC ID) F24B9
Hit Gene Code At1g07900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX655320 [GenBank]


Last Updated on 10.06.2021 13:37