SimpleSearch - Line and FST details


Line specific information

 
Line ID 597E06
Vector Used pGABI1
Line Availability available as T3 set from NASC (N457270)
Segregation Analysis 50:49:46
Confirmed for Hit At4g34180
Parent of DUPLO pair none
Parent of pair(s) 9530, 60849

Gene hit At4g34180

 
Sequence (A. th genome BLAST matches underlined) 
>45-K025558-022-597-E06-8409
GNAGCCATTTACAATTGAATATATACTCATTGATGTCTGTATTCTCACCAACCATTTAGC
CCCATCGGTCATGAACCCAGCAAAGCTTGAATCAAACTCTTTCTTAAACATAAGCCGCCT
AATATATATATCAAACACAGAGTGAGTAAGCTTATGCTCTCTATGGGATCCTCCCTATAG
TGAGACNNANNNNNC
GenBank Accession CR356513 [GenBank]
Graphic View Graphic view of gene At4g34180
Predicted Position of Insertion Chr4:16370556 - go to primer design
BLAST e Value 8e-66
Hit Clone Code (BAC ID) F28A23
Hit Gene Code At4g34180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37