SimpleSearch - Line and FST details


Line specific information

 
Line ID 599E02
Vector Used pAC161
Line Availability available as T3 set from NASC (N457458)
Segregation Analysis 50:47:40
Confirmed for Hit At1g66800
Parent of DUPLO pair none
Parent of pair(s) 508, 6308, 6375, 87546, 87571, 87587, 87588, 87589, 87591, 87592, 87594

Gene hit At1g66800

 
Sequence (A. th genome BLAST matches underlined) 
>13-K023140-022-599-E02-8409
TCATGTAAAAGCTCTTTGAATGTCTTTCATTGTTACATCTGGATCAGCAAGTATGTATCT
GCCACTATGGGATCCTCCCTATAGTGAGNCNNNNNNNNNN
GenBank Accession BX892184 [GenBank]
Graphic View Graphic view of gene At1g66800
Predicted Position of Insertion Chr1:24925984 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) F4N21
Hit Gene Code At1g66800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR813007 [GenBank] BX651404 [GenBank]


Last Updated on 10.06.2021 13:37