SimpleSearch - Line and FST details


Line specific information

 
Line ID 604E11
Vector Used pAC161
Line Availability available as T3 set from NASC (N457947)
Segregation Analysis 50:24:10
Confirmed for Hit At3g05420
Parent of DUPLO pair 12030
Parent of pair(s) none

Gene hit At3g05420

 
Sequence (A. th genome BLAST matches underlined) 
>85-K024444-022-604-E11-8409
CATCTGGTGTAATGAACTTCCTGATCTAGAGGAAGCCTCTTGCTAAGGATAGTGCGATTG
GGCGATGACCCTGACTCCAATGGCTATATCCCGTCAATCCACTTGCTTTGACGACGTGGT
TGGGCCGACGTTGTTTTCGATGACGCTCCCCAAGGAAGGGTGGTGCTATGCAAAATATAT
TAGGAGGGAGATT
GenBank Accession FR813074 [GenBank]
Graphic View Graphic view of gene At3g05420
Predicted Position of Insertion Chr3:1566318 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) F22F7
Hit Gene Code At3g05420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acyl-CoA binding protein 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37