SimpleSearch - Line and FST details


Line specific information

 
Line ID 631C08
Vector Used pAC161
Line Availability available as T3 set from NASC (N460512)
Segregation Analysis 39:15:9
Confirmed for Hit At3g59100
Parent of DUPLO pair none
Parent of pair(s) 5459, 5466, 5482, 5484, 5524, 5543, 5568, 92354, 92363

Gene hit At3g59100

 
Sequence (A. th genome BLAST matches underlined) 
>59-K023206-022-631-C08-8409
CCTCCCTATAGAGAGTCGTATTACCCCCCCATATGGACGAGCATGAACACACGAAGATGG
AACCACCCTATAATGCCTATCTCTGAGNTACCGCATATAAAGGAAACGCTACCTGACATA
TATGCCTGCTAAACAGAACAGGACAATGATGACAACATTGCTCTCTAC
GenBank Accession BX892781 [GenBank]
Graphic View Graphic view of gene At3g59100
Predicted Position of Insertion Chr3:21848505 - go to primer design
BLAST e Value 9e-29
Hit Clone Code (BAC ID) F17J16
Hit Gene Code At3g59100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glucan synthase-like 11
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX892781 [GenBank]


Last Updated on 10.06.2021 13:37