SimpleSearch - Line and FST details


Line specific information

 
Line ID 632B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N460597)
Segregation Analysis 60:45:42
Confirmed for Hit At5g09970
Parent of DUPLO pair none
Parent of pair(s) 92258, 92259, 92260, 92261, 92262

Gene hit At5g09970

 
Sequence (A. th genome BLAST matches underlined) 
>66-K022801-022-632-B09-8409
GAGCATTTACATTTTGGTTCAGAGCCACGATAACCGGCGTTGAACCAAGGCTAAAAGCCA
TAATCTCAGTGTTGGCTCGGCTCCAAGCCATGGCTGCTAACGTCCGATGAGCCNAGCCTC
GGCTGAGAGTGACCACACTGCCGAATACTGGTATGCCACGA
GenBank Accession BX658154 [GenBank]
Graphic View Graphic view of gene At5g09970
Predicted Position of Insertion Chr5:3112608 - go to primer design
BLAST e Value 9e-66
Hit Clone Code (BAC ID) MYH9
Hit Gene Code At5g09970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 78, subfamily A, polypeptide 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX658153 [GenBank]


Last Updated on 10.06.2021 13:37