SimpleSearch - Line and FST details
Line specific information
| Line ID | 632G08 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N460656) |
| Segregation Analysis | 50:42:27 |
| Confirmed for Hit | At2g35640 |
| Parent of DUPLO pair | 11760 |
| Parent of pair(s) | none |
Gene hit At2g35640
| Sequence (A. th genome BLAST matches underlined) | >63-K022797-022-632-G08-8409 TGACACTCCAAGAATCAGCGTCAGCCATATATGTGTCTCTTTGGATT |
| GenBank Accession | BX658211 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr2:14982896 - go to primer design |
| BLAST e Value | 3e-10 |
| Hit Clone Code (BAC ID) | T20F21 |
| Hit Gene Code | At2g35640 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Homeodomain-like superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BX658212 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |




gabi-kat.de 
