SimpleSearch - Line and FST details


Line specific information

 
Line ID 642C12
Vector Used pAC161
Line Availability available as T3 set from NASC (N461572)
Segregation Analysis 50:18:12
Confirmed for Hit At2g40750
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g40750

 
Sequence (A. th genome BLAST matches underlined) 
>91-K022258-022-642-C12-8409
AGTTTCTCCCCATCAATACTGATTTTGATGTATCATCATACTTCCTCTTGTCTTGCCAAA
CCAATGACCCTTCCTCACCTGTCTAAGAGCCCTCATAATAATCTTTACTCTGATCACCAT
TGTTATTTTGTTCCTCCTTAACCATGCCTGCGTCTATTGCTGTCACACTGCTGGTGTTGT
TCTCTTGCTCTTGCCCCATAGCATTGACATGGTTCTGAGCATTGCTATGGGATCCTCCCC
GenBank Accession BX659044 [GenBank]
Graphic View Graphic view of gene At2g40750
Predicted Position of Insertion Chr2:17000681 - go to primer design
BLAST e Value 4e-83
Hit Clone Code (BAC ID) T7D17
Hit Gene Code At2g40750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 54
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX893186 [GenBank]


Last Updated on 10.06.2021 13:37