SimpleSearch - Line and FST details


Line specific information

 
Line ID 642H10
Vector Used pAC161
Line Availability available as T3 set from NASC (N461630)
Segregation Analysis 50:43:23
Confirmed for Hit At2g24840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g24840

 
Sequence (A. th genome BLAST matches underlined) 
>80-K022817-022-642-H10-8409
GGATATTGTCGAGACGACTAAACATTCCGGTGGTACAACTATGGAAAGAGAGCCTCCGGC
AAGTCACATTCTCCAAACGCAGAGCCGGTCTCTTCAAGAAAGCTATGGGATCCTCCCTAT
AGTGAGTCGTATTACTC
GenBank Accession BX659112 [GenBank]
Graphic View Graphic view of gene At2g24840
Predicted Position of Insertion Chr2:10581259 - go to primer design
BLAST e Value 1e-24
Hit Clone Code (BAC ID) F27C12
Hit Gene Code At2g24840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 61
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX893259 [GenBank] BX659112 [GenBank]


Last Updated on 10.06.2021 13:37