SimpleSearch - Line and FST details


Line specific information

 
Line ID 647D06
Vector Used pAC161
Line Availability available as T3 set from NASC (N462058)
Segregation Analysis 50:5:3
Confirmed for Hit At3g59890
Parent of DUPLO pair none
Parent of pair(s) 12442

Gene hit At3g59890

 
Sequence (A. th genome BLAST matches underlined) 
>44-K022742-022-647-D06-8409
TGACTACTTTAAAGATCCCTTCATCGAGCCAATGTCGGAAGAGAGTGATCTCCAGTTCAA
AGACGGTATGGAATCCTCCCTATTTAGAGACGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession FR814002 [GenBank]
Graphic View Graphic view of gene At3g59890
Predicted Position of Insertion Chr3:22126391 - go to primer design
BLAST e Value 1e-06
Hit Clone Code (BAC ID) F24G16
Hit Gene Code At3g59890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dihydrodipicolinate reductase, bacterial/plant
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX893498 [GenBank] BX893497 [GenBank] BX659655 [GenBank] FR814002 [GenBank]


Last Updated on 10.06.2021 13:37