SimpleSearch - Line and FST details


Line specific information

 
Line ID 655B06
Vector Used pAC161
Line Availability available as T3 set from NASC (N462802)
Segregation Analysis 50:49:45
Confirmed for Hit At5g45900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g45900

Sequence (A. th genome BLAST matches underlined)
>42-K023148-022-655-B06-8409
CGACCGTATGGGGATCCTCCCTATAGTGAGTCAAAGGGATCTTTCCAGCAATGGAAACTA
TGGGGATCCTCCCTATAGTGAGCCTAAGG
GenBank Accession FR814173 [GenBank]
Graphic View Graphic view of gene At5g45900
Predicted Position of Insertion Chr5:18617266 - go to primer design
BLAST e Value 0.23
Hit Clone Code (BAC ID) K15I22
Hit Gene Code At5g45900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ThiF family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details