SimpleSearch - Line and FST details


Line specific information

 
Line ID 655G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N462860)
Segregation Analysis 50:50:36
Confirmed for Hit At5g40350
Parent of DUPLO pair none
Parent of pair(s) 2651, 65301

Gene hit At5g40350

 
Sequence (A. th genome BLAST matches underlined) 
>31-K022840-022-655-G04-8409
CATTTACAATTGGTGGGTATAACAAAGCTTTTCACTCTTTTCAGCCATTTGTTTGAGTTT
TAAACACGTTTCGAAATTCCCTCACCACTAACATTAAAAAACCTCGTGCCGATTCTACCA
CAACTTGTGCATGATTGTAATTCTTTTACACGACCATATACAAAGACAAGTACCAAAATA
TACATCTGTTTTTCCTCAACACAAATGTATACGCATAAAAGTGATAAATACCGAAAGACA
AATATTCCACATGGTGGTG
GenBank Accession BX660538 [GenBank]
Graphic View Graphic view of gene At5g40350
Predicted Position of Insertion Chr5:16139692 - go to primer design
BLAST e Value 6e-119
Hit Clone Code (BAC ID) MPO12
Hit Gene Code At5g40350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 24
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR398181 [GenBank]


Last Updated on 10.06.2021 13:37