SimpleSearch - Line and FST details


Line specific information

 
Line ID 657E09
Vector Used pAC161
Line Availability available as T3 set from NASC (N463033)
Segregation Analysis 50:31:26
Confirmed for Hit At3g11250
Parent of DUPLO pair none
Parent of pair(s) 9049, 11475

Gene hit At3g11250

 
Sequence (A. th genome BLAST matches underlined) 
>69-K023092-022-657-E09-8409
CTTCTTCGTCTGACTTCTTCATTTCTTCCCCTCTACCTGTAGCTGATTCTCCATACTTGA
ACACTACCACCACCTGCATCCGCAGACACTGCCGCTGCAGCAACAACAAACTTGCTGGGA
TCCTGCATTTCGAATTTACACCAAAGAGT
GenBank Accession BX660602 [GenBank]
Graphic View Graphic view of gene At3g11250
Predicted Position of Insertion Chr3:3522816 - go to primer design
BLAST e Value 4e-43
Hit Clone Code (BAC ID) F11B9
Hit Gene Code At3g11250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L10 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX660602 [GenBank]


Last Updated on 10.06.2021 13:37