SimpleSearch - Line and FST details


Line specific information

 
Line ID 657F04
Vector Used pAC161
Line Availability available as T3 set from NASC (N463040)
Segregation Analysis 50:45:42
Confirmed for Hit At2g17430
Parent of DUPLO pair none
Parent of pair(s) 4049, 9939, 9954, 96036
Note

Gene hit At2g47890

 
Sequence (A. th genome BLAST matches underlined) 
>30-K023194-022-657-F04-8409
CAGAAGCCATTTACATTGAATATTACCAGCTCTATTACCAGCTCGCATGTAGAAAACAAA
TCCGGCACTATGGGATCCTCCCTATAGTGAGGCTAAGGACTCCCGC
GenBank Accession BX893977 [GenBank]
Graphic View Graphic view of gene At2g47890
Predicted Position of Insertion Chr2:19608964 - go to primer design
BLAST e Value 4e-12
Hit Clone Code (BAC ID) F17A22
Hit Gene Code At2g47890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation B-box type zinc finger protein with CCT domain-containing protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At2g17430

 
Sequence (A. th genome BLAST matches underlined) 
>30-K023092-022-657-F04-8409
CATTGAATATATCCTGGATCCATGGCTTCAATTGGTTACAATTGAGATAGAAGGAAATGG
AGAGATGGAACATTTA
GenBank Accession BX660605 [GenBank]
Graphic View Graphic view of gene At2g17430
Predicted Position of Insertion Chr2:7569284 - go to primer design
BLAST e Value 4e-09
Hit Clone Code (BAC ID) F5J6
Hit Gene Code At2g17430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Seven transmembrane MLO family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37