SimpleSearch - Line and FST details


Line specific information

 
Line ID 669A05
Vector Used pAC161
Line Availability available as T3 set from NASC (N464133)
Segregation Analysis 50:50:36
Confirmed for Hit At1g56170
Parent of DUPLO pair none
Parent of pair(s) 9683

Gene hit At1g56170

 
Sequence (A. th genome BLAST matches underlined) 
>33-K024027-022-669-A05-8409
ACACTGATAGTTTAACCGAAGGCGGGAAACGACAATCTGATCCCCGGGTATGGGATCCTC
CCTATAGTGAGAATATTAAGGAGCTCTGTCATGGAGAGGACAGCGGCGATGTCCTTCTTC
TGCAAGGTCCTCCTCTTGTTCTCCTCGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX894555 [GenBank]
Graphic View Graphic view of gene At1g56170
Predicted Position of Insertion Chr1:21025600 - go to primer design
BLAST e Value 6e-17
Hit Clone Code (BAC ID) T6H22
Hit Gene Code At1g56170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit C2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37