SimpleSearch - Line and FST details


Line specific information

 
Line ID 670B01
Vector Used pAC161
Line Availability available as T3 set from NASC (N464237)
Segregation Analysis 50:47:46
Confirmed for Hit At1g72840
Parent of DUPLO pair none
Parent of pair(s) 2686, 96378

Gene hit At1g72840

 
Sequence (A. th genome BLAST matches underlined) 
>02-K023074-022-670-B01-8409
ACACTGATAGTTTATACCGAAGGCGGGAGAACGACCATCTGATCCCCGAGTATGGGATCC
TCCCTATAGTGAGTGGAAGCTGGATCCCAAGAGATAAAGGAGAGACTCGGGCATCAAAAA
GTTTTTGTCGTGCTTGATAATGTCGATAAAGTGGAGCAGTTACATGGCCTGGCAAAGGAC
CCAATCTGGTTCGGCCCAGG
GenBank Accession BX661010 [GenBank]
Graphic View Graphic view of gene At1g72840
Predicted Position of Insertion Chr1:27412592 - go to primer design
BLAST e Value 5e-61
Hit Clone Code (BAC ID) F3N23
Hit Gene Code At1g72840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (TIR-NBS-LRR class)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37