SimpleSearch - Line and FST details


Line specific information

 
Line ID 676E04
Vector Used pAC161
Line Availability available as T3 set from NASC (N464852)
Segregation Analysis 50:50:37
Confirmed for Hit At1g26270
Parent of DUPLO pair none
Parent of pair(s) 9043, 11479

Gene hit At1g26270

 
Sequence (A. th genome BLAST matches underlined) 
>29-K023001-022-676-E04-8409
GCCATTTACATTGTGCAGAGAACTAGAACACGGAGACTGGCCTCTCGTATGGGATCCTCC
CTATAGTGAGA
GenBank Accession BX661546 [GenBank]
Graphic View Graphic view of gene At1g26270
Predicted Position of Insertion Chr1:9090495 - go to primer design
BLAST e Value 8e-14
Hit Clone Code (BAC ID) F28B23
Hit Gene Code At1g26270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphatidylinositol 3- and 4-kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX661546 [GenBank]


Last Updated on 10.06.2021 13:37