SimpleSearch - Line and FST details


Line specific information

 
Line ID 676F05
Vector Used pAC161
Line Availability available as T3 set from NASC (N464865)
Segregation Analysis 50:50:36
Confirmed for Hit At3g57830
Parent of DUPLO pair 6801
Parent of pair(s) none

Gene hit At3g57830

 
Sequence (A. th genome BLAST matches underlined) 
>38-K022971-022-676-F05-8409
AGCCATTTACATTGAATATATACTCATTTGGATGTTGGACTCTACTCACATCAACCACTT
CATTTTCGAAATCCTTCCGCCGCCACGTCTTATCTCCGTCGCTTAGCCTTCTCACAGCAA
CGACGGTGGATGACGTAAACGTAGCCGCCACTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX661559 [GenBank]
Graphic View Graphic view of gene At3g57830
Predicted Position of Insertion Chr3:21421022 - go to primer design
BLAST e Value 2e-48
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37