SimpleSearch - Line and FST details
Line specific information
| Line ID | 679F03 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N465151) |
| Segregation Analysis | 50:48:45 |
| Confirmed for Hit | At2g01220 |
| Parent of DUPLO pair | 11938 |
| Parent of pair(s) | none |
Gene hit At2g01220
| Sequence (A. th genome BLAST matches underlined) | >22-K023109-022-679-F03-8409 ATATATCCTGATTTACAATTATAGCTCGACTCTGGATCATAAAACTGATTGGTCTTTCTC TATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN |
| GenBank Accession | BX661861 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr2:125522 - go to primer design |
| BLAST e Value | 1e-18 |
| Hit Clone Code (BAC ID) | F10A8 |
| Hit Gene Code | At2g01220 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Nucleotidylyl transferase superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BX894600 [GenBank] |
Gene hit At4g17200
| Sequence (A. th genome BLAST matches underlined) | >22-K023962-022-679-F03-8409 ATTGAATACGACAATGTCTGATCTTTCACCAGATTTGGTAGGGGAGATTCTCACTATGGG ATCCTCCCTATAGTGAGACNNANNNNNCNNNNNNNNNN |
| GenBank Accession | BX894601 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr4:9651111 - go to primer design |
| BLAST e Value | 3e-19 |
| Hit Clone Code (BAC ID) | FCAALL |
| Hit Gene Code | At4g17200 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | F-box and associated interaction domains-containing protein |
| Insertion Classification | CDSi |
| Confirmation Status | unknown |
|
Last Updated on 10.06.2021 13:37 |





gabi-kat.de 
