SimpleSearch - Line and FST details


Line specific information

 
Line ID 679F03
Vector Used pAC161
Line Availability available as T3 set from NASC (N465151)
Segregation Analysis 50:48:45
Confirmed for Hit At2g01220
Parent of DUPLO pair 11938
Parent of pair(s) none

Gene hit At2g01220

 
Sequence (A. th genome BLAST matches underlined) 
>22-K023109-022-679-F03-8409
ATATATCCTGATTTACAATTATAGCTCGACTCTGGATCATAAAACTGATTGGTCTTTCTC
TATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX661861 [GenBank]
Graphic View Graphic view of gene At2g01220
Predicted Position of Insertion Chr2:125522 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) F10A8
Hit Gene Code At2g01220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotidylyl transferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX894600 [GenBank]

Gene hit At4g17200

 
Sequence (A. th genome BLAST matches underlined) 
>22-K023962-022-679-F03-8409
ATTGAATACGACAATGTCTGATCTTTCACCAGATTTGGTAGGGGAGATTCTCACTATGGG
ATCCTCCCTATAGTGAGACNNANNNNNCNNNNNNNNNN
GenBank Accession BX894601 [GenBank]
Graphic View Graphic view of gene At4g17200
Predicted Position of Insertion Chr4:9651111 - go to primer design
BLAST e Value 3e-19
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box and associated interaction domains-containing protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37