SimpleSearch - Line and FST details
Line specific information
| Line ID | 679F11 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N465159) |
| Segregation Analysis | 50:46:38 |
| Confirmed for Hit | At5g49020 |
| Parent of DUPLO pair | 12081 |
| Parent of pair(s) | none |
Gene hit At5g49020
| Sequence (A. th genome BLAST matches underlined) | >86-K023109-022-679-F11-8409 AAATTTTTTTACAGGAAAACAATTTTATGAGATTGTATCCCGTTGAAG |
| GenBank Accession | FR814475 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:19873846 - go to primer design |
| BLAST e Value | 2e-04 |
| Hit Clone Code (BAC ID) | K19E20 |
| Hit Gene Code | At5g49020 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | protein arginine methyltransferase 4A |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BX661867 [GenBank] FR814475 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
