SimpleSearch - Line and FST details
Line specific information
Line ID | 679F11 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N465159) |
Segregation Analysis | 50:46:38 |
Confirmed for Hit | At5g49020 |
Parent of DUPLO pair | 12081 |
Parent of pair(s) | none |
Gene hit At5g49020
Sequence (A. th genome BLAST matches underlined) | >86-K023109-022-679-F11-8409 AAATTTTTTTACAGGAAAACAATTTTATGAGATTGTATCCCGTTGAAG |
GenBank Accession | FR814475 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:19873846 - go to primer design |
BLAST e Value | 2e-04 |
Hit Clone Code (BAC ID) | K19E20 |
Hit Gene Code | At5g49020 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | protein arginine methyltransferase 4A |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | BX661867 [GenBank] FR814475 [GenBank] |
Last Updated on 10.06.2021 13:37 |