SimpleSearch - Line and FST details


Line specific information

 
Line ID 679F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N465159)
Segregation Analysis 50:46:38
Confirmed for Hit At5g49020
Parent of DUPLO pair 12081
Parent of pair(s) none

Gene hit At5g49020

 
Sequence (A. th genome BLAST matches underlined)
>86-K023109-022-679-F11-8409
AAATTTTTTTACAGGAAAACAATTTTATGAGATTGTATCCCGTTGAAG
GenBank Accession FR814475 [GenBank]
Graphic View Graphic view of gene At5g49020
Predicted Position of Insertion Chr5:19873846 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) K19E20
Hit Gene Code At5g49020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein arginine methyltransferase 4A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX661867 [GenBank] FR814475 [GenBank]


Last Updated on 10.06.2021 13:37