SimpleSearch - Line and FST details


Line specific information

 
Line ID 681G05
Vector Used pAC161
Line Availability available as T3 set from NASC (N465357)
Segregation Analysis 50:50:40
Confirmed for Hit At1g26798
Parent of DUPLO pair none
Parent of pair(s) 86390, 86393, 86395, 86397

Gene hit At3g27380

 
Sequence (A. th genome BLAST matches underlined) 
>39-K023120-022-681-G05-8409
AAGCTCCTCTACTTGGGAAGTACTTGCAGACCATGTGTTTTATGGCGCTAATATTTGGCA
ACAACCATACCAGAATGAATTGAAAATCCGAAGAGGNTTTGNGAA
GenBank Accession BX894697 [GenBank]
Graphic View Graphic view of gene At3g27380
Predicted Position of Insertion Chr3:10131038 - go to primer design
BLAST e Value 8e-23
Hit Clone Code (BAC ID) K1G2
Hit Gene Code At3g27380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation succinate dehydrogenase 2-1
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g26798

 
Sequence (A. th genome BLAST matches underlined) 
>39-K023157-022-681-G05-8409
ATTTTAATTTGATATTTTTAGAGTAGATAGAGAAGATAATTCAAAAAGTACATGTGGAAT
ATGTAGAGAATGTATTTGGCATATTTG
GenBank Accession BX894698 [GenBank]
Graphic View Graphic view of gene At1g26798
Predicted Position of Insertion Chr1:9282108 - go to primer design
BLAST e Value 1e-33
Hit Clone Code (BAC ID) T24P13
Hit Gene Code At1g26798 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant self-incompatibility protein S1 family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37