SimpleSearch - Line and FST details


Line specific information

 
Line ID 681G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N465364)
Segregation Analysis 50:40:30
Confirmed for Hit At1g14600
Parent of DUPLO pair 11732
Parent of pair(s) none

Gene hit At1g14600

 
Sequence (A. th genome BLAST matches underlined) 
>95-K023045-022-681-G12-8409
NNGGCAGAATCCGGACATGAGCCTTTACATTGAATATATCCTGATAACATACCTATTTTC
TGGGATCCTCCCTATAGCGTGTCGTATAAAACTTAGGATTCCCTTTCCGCTTTTTGCCAA
GGAA
GenBank Accession FR814495 [GenBank]
Graphic View Graphic view of gene At1g14600
Predicted Position of Insertion Chr1:5002204 - go to primer design
BLAST e Value 0.001
Hit Clone Code (BAC ID) T5E21
Hit Gene Code At1g14600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37