SimpleSearch - Line and FST details


Line specific information

 
Line ID 683D05
Vector Used pAC161
Line Availability available as T3 set from NASC (N465513)
Segregation Analysis 50:45:34
Confirmed for Hit At3g18090
Parent of DUPLO pair none
Parent of pair(s) 12058

Gene hit At3g18090

 
Sequence (A. th genome BLAST matches underlined)
>36-K023046-022-683-D05-8409
CCGGACATGAAGCCATTTACAATTGAATATATCCTGACATAACAGACATGATCCCGTACA
GGAACATATACCCTATCCTCAATGGTCGGAGGATGCGCACACTCTGCAATATGGCCCTCT
GATCTTTCTTCCACTGCTTGGAGTCCTCTCGATCACATTCGCATAGGCCTTGCATCTCCT
GCCCACGCCCAT
GenBank Accession BX662044 [GenBank]
Graphic View Graphic view of gene At3g18090
Predicted Position of Insertion Chr3:6200148 - go to primer design
BLAST e Value 7e-45
Hit Clone Code (BAC ID) MRC8
Hit Gene Code At3g18090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear RNA polymerase D2B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX894785 [GenBank] BX894786 [GenBank]


Last Updated on 10.06.2021 13:37