SimpleSearch - Line and FST details


Line specific information

 
Line ID 683G07
Vector Used pAC161
Line Availability available as T3 set from NASC (N465551)
Segregation Analysis 50:50:48
Confirmed for Hit At5g43850
Parent of DUPLO pair none
Parent of pair(s) 802, 63013, 94498

Gene hit At5g43850

 
Sequence (A. th genome BLAST matches underlined) 
>55-K023158-022-683-G07-8409
GAGAGAGAGAGGAAACAGGCAAACCCTGTATTGTTTCTCCGAGACCCTAGTCCTACTGTC
CTATGATACATGATTTTT
GenBank Accession BX894816 [GenBank]
Graphic View Graphic view of gene At5g43850
Predicted Position of Insertion Chr5:17628043 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) MQD19
Hit Gene Code At5g43850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RmlC-like cupins superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX894816 [GenBank]


Last Updated on 10.06.2021 13:37