SimpleSearch - Line and FST details


Line specific information

 
Line ID 684D08
Vector Used pAC161
Line Availability available as T3 set from NASC (N465612)
Segregation Analysis 50:36:35
Confirmed for Hit At3g46490
Parent of DUPLO pair none
Parent of pair(s) 3804, 9859, 93001

Gene hit At3g46490

 
Sequence (A. th genome BLAST matches underlined) 
>60-K023118-022-684-D08-8409
ATTACAATTGAATAATATTCTGCGCGGCAGGAATCATGCTTCCCAAGTAAGCGTTCAACA
CTTCACCTTGTTACATTAAGACCTTCAACTATGGGATCCTCCCTATAGTGAGNCGNATTA
CTCNN
GenBank Accession BX894871 [GenBank]
Graphic View Graphic view of gene At3g46490
Predicted Position of Insertion Chr3:17119270 - go to primer design
BLAST e Value 8e-17
Hit Clone Code (BAC ID) F12A12
Hit Gene Code At3g46490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37