SimpleSearch - Line and FST details


Line specific information

 
Line ID 684G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N465652)
Segregation Analysis 50:49:37
Confirmed for Hit At3g01970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g01970

 
Sequence (A. th genome BLAST matches underlined) 
>95-K023047-022-684-G12-8409
CATTTACAATTGAATATATATTGAAAATATGGCTACATTAGCGGATCCATCACAGAAAAA
GAGTTTTGTGGAAACAAAAAGGTGTGGCGGCTACATCATTCTGATTTATATTATTATATA
TGCAACTCCTTCCAATTTTGGTTCAATGGATTCAAATTTCAAACATATTTCTTGCTCACC
AATCCCTATCC
GenBank Accession BX662095 [GenBank]
Graphic View Graphic view of gene At3g01970
Predicted Position of Insertion Chr3:327262 - go to primer design
BLAST e Value 1e-83
Hit Clone Code (BAC ID) F1C9
Hit Gene Code At3g01970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 45
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37