SimpleSearch - Line and FST details


Line specific information

 
Line ID 686A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N465769)
Segregation Analysis 50:44:32
Confirmed for Hit At1g65380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g65380

Sequence (A. th genome BLAST matches underlined)
>65-K023073-022-686-A09-8409
TTTGTACGCCTTAGGGAGCTTAGAGAAGTTGTCCATACTGAGAGTCCACATGTGGGCTCG
GTCCGCCGCATGGGATCCTCCC
GenBank Accession FR814551 [GenBank]
Graphic View Graphic view of gene At1g65380
Predicted Position of Insertion Chr1:24287329 - go to primer design
BLAST e Value 0.055
Hit Clone Code (BAC ID) T8F5
Hit Gene Code At1g65380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat (LRR) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details