SimpleSearch - Line and FST details


Line specific information

 
Line ID 686D07
Vector Used pAC161
Line Availability available as T3 set from NASC (N465803)
Segregation Analysis 50:49:45
Confirmed for Hit At2g30140
Parent of DUPLO pair none
Parent of pair(s) 9590

Gene hit At2g30140

 
Sequence (A. th genome BLAST matches underlined)
>52-K023073-022-686-D07-8409
GTGAGGTTAGGGTATCGACGGACAAGGCGTTTGCAGAGGTTCATCATAGGGTTGATGTGT
CCTCGACCTGGATAAGGCATGGCCACCACGTGGCGAAATTGGTTTGT
GenBank Accession BX662138 [GenBank]
Graphic View Graphic view of gene At2g30140
Predicted Position of Insertion Chr2:12872324 - go to primer design
BLAST e Value 2e-51
Hit Clone Code (BAC ID) T27E13
Hit Gene Code At2g30140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662138 [GenBank]


Last Updated on 10.06.2021 13:37