SimpleSearch - Line and FST details


Line specific information

 
Line ID 686F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N465831)
Segregation Analysis 50:49:38
Confirmed for Hit At1g14970
Parent of DUPLO pair none
Parent of pair(s) 156, 3148, 97288

Gene hit At1g14970

 
Sequence (A. th genome BLAST matches underlined)
>86-K022872-022-686-F11-8409
ACAGATAGAATGATCCCTGAGAGACGGTGAGCGACGTTCCGACTTTGCTGACGCCCCGAG
AC
GenBank Accession BX662168 [GenBank]
Graphic View Graphic view of gene At1g14970
Predicted Position of Insertion Chr1:5164736 - go to primer design
BLAST e Value 4e-15
Hit Clone Code (BAC ID) T15D22
Hit Gene Code At1g14970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662168 [GenBank]


Last Updated on 10.06.2021 13:37