SimpleSearch - Line and FST details
Line specific information
| Line ID | 686F11 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N465831) |
| Segregation Analysis | 50:49:38 |
| Confirmed for Hit | At1g14970 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 156, 3148, 97288 |
Gene hit At1g14970
| Sequence (A. th genome BLAST matches underlined) | >86-K022872-022-686-F11-8409 ACAGATAGAATGATCCCTGAGAGACGGTGAGCGACGTTCCGACTTTGCTGACGCCCCGAG AC |
| GenBank Accession | BX662168 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr1:5164736 - go to primer design |
| BLAST e Value | 4e-15 |
| Hit Clone Code (BAC ID) | T15D22 |
| Hit Gene Code | At1g14970 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | O-fucosyltransferase family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BX662168 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |




gabi-kat.de 
