SimpleSearch - Line and FST details


Line specific information

 
Line ID 688F07
Vector Used pAC161
Line Availability available as T3 set from NASC (N466019)
Segregation Analysis 50:45:34
Confirmed for Hit F15O5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15O5

 
Sequence (A. th genome BLAST matches underlined) 
>54-K023078-022-688-F07-8409
GTTGATTGGATTTAGTTCATTCCACCGATACTATTAATGACTAATGAGAATATATTGGGC
TGTACCAATACTAGGAATGAGCATGTATTGGGCTGTATGATAAACCAAAACATTGGGCTG
AGCCATGTAATGATTTTTCTTCTGATGCATTTTAATAG
GenBank Accession BX662375 [GenBank]
Graphic View Graphic view of sequence BX662375 of line 688F07
Predicted Position of Insertion Chr5:25997124 - go to primer design
BLAST e Value 9e-75
Hit Clone Code (BAC ID) F15O5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662376 [GenBank]


Last Updated on 10.06.2021 13:37