SimpleSearch - Line and FST details


Line specific information

 
Line ID 692H03
Vector Used pGABI1
Line Availability available as T3 set from NASC (N466423)
Segregation Analysis 50:41:33
Confirmed for Hit At2g45720
Parent of DUPLO pair 11727
Parent of pair(s) none

Gene hit At2g45720

 
Sequence (A. th genome BLAST matches underlined) 
>24-K025067-022-692-H03-8409
ACCTTTAGCTTCTTCAACTCCAGACATGGAAACATTCATCGTAAAAGAATTGCTTGCTCT
TCTCCAAACATGTCACGTATGCATCTCACACCGCATCACTTGACCTTCTCTGTCCATGAT
TGAAACAAAACGATCAGGCTGTTATCCCCCCTCTAGGCCGTATGGGATCCTCCCTATAGT
GAGNNNNNNNANNNNNNNNNNNNNNNN
GenBank Accession FR814657 [GenBank]
Graphic View Graphic view of gene At2g45720
Predicted Position of Insertion Chr2:18834779 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) F17K2
Hit Gene Code At2g45720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814657 [GenBank]


Last Updated on 10.06.2021 13:37