SimpleSearch - Line and FST details


Line specific information

 
Line ID 701E04
Vector Used pAC161
Line Availability available as T3 set from NASC (N467252)
Segregation Analysis 60:22:15
Confirmed for Hit At4g28410
Parent of DUPLO pair none
Parent of pair(s) 5183, 5210, 5221, 7489, 10204, 11310, 11323

Gene hit At4g28410

 
Sequence (A. th genome BLAST matches underlined)
>29-K025311-022-701-E04-8409
ATTGAACATCTACAGAAGAGTACGTGAAAAGTGAAAACTATTTACTTTCTTTGAACAAAA
CTTTTGTTAAACATTTTATTATGACGTACAGGTGGCTGAAGTGTCCAGAAAGCTATGGGA
TCCTCCCTATAGTGAGAC
GenBank Accession CR356623 [GenBank]
Graphic View Graphic view of gene At4g28410
Predicted Position of Insertion Chr4:14053383 - go to primer design
BLAST e Value 9e-41
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tyrosine transaminase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37