SimpleSearch - Line and FST details


Line specific information

 
Line ID 708C04
Vector Used pGABI1
Line Availability available as T3 set from NASC (N467900)
Segregation Analysis 50:49:43
Confirmed for Hit At4g14365
Parent of DUPLO pair 12891
Parent of pair(s) none

Gene hit At4g14365

 
Sequence (A. th genome BLAST matches underlined) 
>27-K023060-022-708-C04-8409
ATCTCCTCGATGGCTGGAAGATATTGATACTATCTCCTTACTATTGGACTTTGTCTATGC
ACGATACCTGAGCGTTTTCCTATAGGAACCCTAATTCCCTTATCTGGGAACTACTCACAC
ATTATTATAGAGAGAGATAGATTTGTAGAGAGAGACTGGGGAGTTCAACGGTCATGCCCG
CATGGGACCCTCCCT
GenBank Accession FR814847 [GenBank]
Graphic View Graphic view of gene At4g14365
Predicted Position of Insertion Chr4:8271671 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14365 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814846 [GenBank] FR814847 [GenBank]


Last Updated on 10.06.2021 13:37