SimpleSearch - Line and FST details


Line specific information

 
Line ID 709D04
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468008)
Segregation Analysis 50:49:35
Confirmed for Hit At2g44270
Parent of DUPLO pair 595
Parent of pair(s) none

Gene hit At2g44270

 
Sequence (A. th genome BLAST matches underlined) 
>28-K022875-022-709-D04-8409
NGGGTGTGAATCCGGAATGAAGCCATTTACAATTGATCAATTGGGAGAAGCTAGTCACTG
GACATAATGCAGATGATATAGCAGATGCCGTTCTCTTGAACATATTGCGAGGGGATATTG
CTAGGAAAGTATTGCTAGGGGATA
GenBank Accession BX662892 [GenBank]
Graphic View Graphic view of gene At2g44270
Predicted Position of Insertion Chr2:18299089 - go to primer design
BLAST e Value 6e-36
Hit Clone Code (BAC ID) F4I1
Hit Gene Code At2g44270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation repressor of lrx1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662892 [GenBank]


Last Updated on 10.06.2021 13:37