SimpleSearch - Line and FST details


Line specific information

 
Line ID 711G12
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468244)
Segregation Analysis 50:50:38
Confirmed for Hit At1g26460
Parent of DUPLO pair 12671
Parent of pair(s) none

Gene hit At1g26460

 
Sequence (A. th genome BLAST matches underlined) 
>95-K022877-022-711-G12-8409
ATTGAATATATAAGCCGAATAAGCCATTTACATTAACTTGATGATGGGTGCTTCTGCTGG
AGATATGCTGGAGCGTGCTGCGGCTGTGGAGAAGCTTGATCTTGTTGCGCCAATGGAGGA
GenBank Accession BX663258 [GenBank]
Graphic View Graphic view of gene At1g26460
Predicted Position of Insertion Chr1:9152307 - go to primer design
BLAST e Value 2e-11
Hit Clone Code (BAC ID) T1K7
Hit Gene Code At1g26460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX663258 [GenBank]


Last Updated on 10.06.2021 13:37