SimpleSearch - Line and FST details


Line specific information

 
Line ID 714B08
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468468)
Segregation Analysis 50:46:36
Confirmed for Hit At1g07420
Parent of DUPLO pair 6785
Parent of pair(s) none

Gene hit At1g07420

 
Sequence (A. th genome BLAST matches underlined) 
>58-K025038-022-714-B08-8409
CGGAATGAGCCATTTACAATTGAATATACATGGGTAATTATCATTGGTAATTACTATTGT
AGATTTTTGTGTATTAATTCGTCTCTGGTGTTCTTCAGGATCTTTGGTATGGGATCCTCC
CTATAGTGAG
GenBank Accession BX945310 [GenBank]
Graphic View Graphic view of gene At1g07420
Predicted Position of Insertion Chr1:2279907 - go to primer design
BLAST e Value 6e-11
Hit Clone Code (BAC ID) F22G5
Hit Gene Code At1g07420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sterol 4-alpha-methyl-oxidase 2-1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX945311 [GenBank]


Last Updated on 10.06.2021 13:37