SimpleSearch - Line and FST details


Line specific information

 
Line ID 715C05
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468573)
Segregation Analysis 50:49:26
Confirmed for Hit At1g28560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g28560

 
Sequence (A. th genome BLAST matches underlined)
>35-K025039-022-715-C05-8409
TTTACATTGAATATGATGATGATTAAAGAACCACAAGAGAAAGAGAGAAGATTTTACCTG
ATGACAATAGACATAACTAGCTCCGACTCTGAATCTTATATCACAGAAGTGTGTATGGGA
TCCTCCCTATAGTGAG
GenBank Accession BX945443 [GenBank]
Graphic View Graphic view of gene At1g28560
Predicted Position of Insertion Chr1:10038538 - go to primer design
BLAST e Value 8e-44
Hit Clone Code (BAC ID) F3M18
Hit Gene Code At1g28560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation snRNA activating complex family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37