SimpleSearch - Line and FST details


Line specific information

 
Line ID 715D10
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468590)
Segregation Analysis 50:50:49
Confirmed for Hit At4g02600
Parent of DUPLO pair none
Parent of pair(s) 3238, 43264

Gene hit At4g02600

 
Sequence (A. th genome BLAST matches underlined) 
>76-K025110-022-715-D10-8409
GATTCTCAAGCTTTTTATTAGTAAATAGCTTGTGACCTGTGAGACGATGGCGTACATATG
CAACGTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNN
GenBank Accession CR356894 [GenBank]
Graphic View Graphic view of gene At4g02600
Predicted Position of Insertion Chr4:1146958 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Seven transmembrane MLO family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37