SimpleSearch - Line and FST details


Line specific information

 
Line ID 717A02
Vector Used pGABI1
Line Availability available as T3 set from NASC (N468738)
Segregation Analysis 50:49:35
Confirmed for Hit At5g06870
Parent of DUPLO pair none
Parent of pair(s) 9597, 89639

Gene hit At5g06870

 
Sequence (A. th genome BLAST matches underlined) 
>09-K025280-022-717-A02-8409
TATCCTGTCCATAAACAACCCTTACCACCTCTCCTCATGGGATCCCAAAACCGACTGTTG
CTCTTGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR357002 [GenBank]
Graphic View Graphic view of gene At5g06870
Predicted Position of Insertion Chr5:2134059 - go to primer design
BLAST e Value 2e-22
Hit Clone Code (BAC ID) MOJ9
Hit Gene Code At5g06870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation polygalacturonase inhibiting protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37