SimpleSearch - Line and FST details


Line specific information

 
Line ID 721A10
Vector Used pGABI1
Line Availability available as T3 set from NASC (N469130)
Segregation Analysis 50:45:43
Confirmed for Hit At1g51170
Parent of DUPLO pair 2650
Parent of pair(s) none

Gene hit At1g51170

 
Sequence (A. th genome BLAST matches underlined) 
>73-K025197-022-721-A10-8409
ACTCTTACTCCTTTGAAAAAGCATGCTCCTTTATCTCCGCCGCGCCTCGACAGAAACCAA
ACCAGCTTCGTCGGATCTTTACCAATAACCGACGGATCAAATCGGTTAAATCCGATGGCT
TTCCCGGCGAATTCTCGTTCCTTCACCAACACGTTACGAAAAGTTTCTTTTTTGTATCTT
CCTTTGAACGGTGTCTCTCCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR357602 [GenBank]
Graphic View Graphic view of gene At1g51170
Predicted Position of Insertion Chr1:18953812 - go to primer design
BLAST e Value 2e-75
Hit Clone Code (BAC ID) F23H24
Hit Gene Code At1g51170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR357602 [GenBank]


Last Updated on 10.06.2021 13:37