SimpleSearch - Line and FST details


Line specific information

 
Line ID 724C11
Vector Used pGABI1
Line Availability available as T3 set from NASC (N750150)
Segregation Analysis 50:27:1
Confirmed for Hit At3g12400
Parent of DUPLO pair none
Parent of pair(s) 12623

Gene hit At3g12400

 
Sequence (A. th genome BLAST matches underlined)
>83-K025362-022-724-C11-8409
NAGCCATTTACATTGAATATATCCTGAAGCATCTTGAAACGACTTATCCAAGGAATAAAT
AGCATCTTCAATGGCTAAATCCAAAGCAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR358067 [GenBank]
Graphic View Graphic view of gene At3g12400
Predicted Position of Insertion Chr3:3944743 - go to primer design
BLAST e Value 4e-27
Hit Clone Code (BAC ID) T2E22
Hit Gene Code At3g12400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-conjugating enzyme/RWD-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37