SimpleSearch - Line and FST details


Line specific information

 
Line ID 726G07
Vector Used pGABI1
Line Availability available as T3 set from NASC (N469679)
Segregation Analysis 50:48:33
Confirmed for Hit At1g07000
Parent of DUPLO pair 2578
Parent of pair(s) none

Gene hit At1g07000

 
Sequence (A. th genome BLAST matches underlined) 
>55-K025199-022-726-G07-8409
AGCCATTTACAATTGAATATATCCTGCAATCGATCTAAGCCATTTTCGTCGCTGGTGGAT
TTGCAAAAGAGTGTTCAAGAGCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR358389 [GenBank]
Graphic View Graphic view of gene At1g07000
Predicted Position of Insertion Chr1:2151619 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein B2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR358388 [GenBank]


Last Updated on 10.06.2021 13:37