SimpleSearch - Line and FST details


Line specific information

 
Line ID 734B03
Vector Used pGABI1
Line Availability available as T3 set from NASC (N470383)
Segregation Analysis 50:50:34
Confirmed for Hit At2g45310
Parent of DUPLO pair none
Parent of pair(s) 3961, 3998, 4036, 4045, 33109

Gene hit At2g45310

 
Sequence (A. th genome BLAST matches underlined) 
>18-K025422-022-734-B03-8409
AACGGAACGTCACCGTTTCGTGGCATCTTAATCAAATTCTTCTTCGCCTTCACTTTCAAT
TGTCTCTCCAATATCCTCACCAGATCTGAAACCGGCACCGGCGACGTGTTTCCGAGGTTA
AACACTCTCAATTGCGCCGGACCTCTCTTCTTCCCTCCACTCCCTGTATGGGATCCTCCC
TATAGTGAG
GenBank Accession CR359173 [GenBank]
Graphic View Graphic view of gene At2g45310
Predicted Position of Insertion Chr2:18683829 - go to primer design
BLAST e Value 3e-90
Hit Clone Code (BAC ID) F4L23
Hit Gene Code At2g45310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-D-glucuronate 4-epimerase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37