SimpleSearch - Line and FST details


Line specific information

 
Line ID 736B11
Vector Used pGABI1
Line Availability available as T3 set from NASC (N470583)
Segregation Analysis 50:49:40
Confirmed for Hit At3g29380
Parent of DUPLO pair none
Parent of pair(s) 58585

Gene hit At3g29380

 
Sequence (A. th genome BLAST matches underlined)
>82-K023733-022-736-B11-8409
GGCGAAATTCGGAAGAAGCATTTACAATTGAATACGATCAAGAACTCGGTTAAAGATATG
TATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX894956 [GenBank]
Graphic View Graphic view of gene At3g29380
Predicted Position of Insertion Chr3:11282548 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) MUO10
Hit Gene Code At3g29380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin-like family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37