SimpleSearch - Line and FST details


Line specific information

 
Line ID 737G06
Vector Used pGABI1
Line Availability available as T3 set from NASC (N470734)
Segregation Analysis 50:50:38
Confirmed for Hit At5g45480
Parent of DUPLO pair none
Parent of pair(s) 9680, 9693, 95206

Gene hit At5g45480

 
Sequence (A. th genome BLAST matches underlined) 
>47-K023553-022-737-G06-8409
NNNNCCGTGCTATTCCGGACATNAGCCATTTACATTGAATATATCCTGGAAACATTCTCG
GGGTCAGGAAATTGAAGGTGGAGGAGTATGATGAATGCTACAAGAATACACAGTCTCATG
AAGTGCCCAACACGAGTATGGGATCCTCCCTATAGTGAGANANTATGGGATCCTCCCTAT
ANTGAG
GenBank Accession BX895123 [GenBank]
Graphic View Graphic view of gene At5g45480
Predicted Position of Insertion Chr5:18427775 - go to primer design
BLAST e Value 4e-43
Hit Clone Code (BAC ID) MFC19
Hit Gene Code At5g45480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein, putative (DUF594)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX895124 [GenBank]


Last Updated on 10.06.2021 13:37