SimpleSearch - Line and FST details


Line specific information

 
Line ID 742A03
Vector Used pAC161
Line Availability available as T3 set from NASC (N471139)
Segregation Analysis 50:50:33
Confirmed for Hit At5g39220
Parent of DUPLO pair 11960
Parent of pair(s) none

Gene hit At5g39220

 
Sequence (A. th genome BLAST matches underlined) 
>17-K023520-022-742-A03-8409
CCCTGTATTGCACCATCCACCTGAAATTCCTGACCTACAAGAATGTTCTTACATCCGTGA
TAGAGATGGCCCCCCATTGTATCTGTTGTTATTTACCCACCACACGAATTTGTATTTCC
GenBank Accession FR815198 [GenBank]
Graphic View Graphic view of gene At5g39220
Predicted Position of Insertion Chr5:15706915 - go to primer design
BLAST e Value 7e-08
Hit Clone Code (BAC ID) K3K3
Hit Gene Code At5g39220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37