SimpleSearch - Line and FST details


Line specific information

 
Line ID 743G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N471308)
Segregation Analysis 50:46:30
Confirmed for Hit At5g26130
Parent of DUPLO pair none
Parent of pair(s) 7764, 9379, 9385, 9399, 9404, 95919

Gene hit At5g26130

 
Sequence (A. th genome BLAST matches underlined) 
>31-K023866-022-743-G04-8409
TGGCTCGTCTTGGGCTCTGACAGGAACTGCAAAAGCTAGTGGGATCCTCCCTATAGTGAG
ACCCACGGGTACATCGGGATAGAGCGAAGGGTCAGGAATTCCTTGGATATCCGTTCGGTA
TCCCACGCCGAGCTTGAGTGCATAGCGCTGGGTTTCCGGTTGGAAGCTGTCCATTGAAAC
NCGGTGCATCTGATCGGACTTGGGGGGGGGGGGGGGGGCAATTTNTCCCATCCCATCNAC
CCCTCAAACAAGCCTCCCAATCAAATAAATCCAACACAAAAC
GenBank Accession FR815221 [GenBank]
Graphic View Graphic view of gene At5g26130
Predicted Position of Insertion Chr5:9128518 - go to primer design
BLAST e Value 9e-04
Hit Clone Code (BAC ID) T1N24
Hit Gene Code At5g26130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37