SimpleSearch - Line and FST details


Line specific information

 
Line ID 748G02
Vector Used pGABI1
Line Availability available as T3 set from NASC (N471786)
Segregation Analysis 50:33:27
Confirmed for Hit At3g53810
Parent of DUPLO pair none
Parent of pair(s) 6266, 6279, 6287, 6317, 6331, 7798, 10606, 87751, 87770, 87790, 87867, 87898, 87913, 87924, 87938, 87953, 87967, 87981, 87983, 87984, 87985, 87986

Gene hit At3g53810

 
Sequence (A. th genome BLAST matches underlined)
>15-K023556-022-748-G02-8409
TTTACAATTGAAGGTTGTGGAGAAGGATGATACGTTGCCGTTTTGGGAATCTTTGAACCG
GATTCGTTCAGTATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX895872 [GenBank]
Graphic View Graphic view of gene At3g53810
Predicted Position of Insertion Chr3:19934920 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37