SimpleSearch - Line and FST details


Line specific information

 
Line ID 764C01
Vector Used pGABI1
Line Availability available as T3 set from NASC (N473273)
Segregation Analysis 50:44:43
Confirmed for Hit At3g17970
Parent of DUPLO pair 2444
Parent of pair(s) none

Gene hit At3g17970

 
Sequence (A. th genome BLAST matches underlined) 
>03-K024030-022-764-C01-8409
CCTCCCTATAGTGAGCAGTCCGTGTTAGCAAAACCAATCCACAGTATATGTGTCTTACAT
TTATCGTGCTGATGATTCCGGTGACTGTGCCACTCCGACATCATGAGAAATGCCCTATTT
CAGTTTCTTTCATAGGAAGACACGGTGGTGACCGCTTTTTACTAGATACAGTGCAGACCA
TGTATCCCTCTTTGCAAGAGTATGGGATCCTCCCCTATAGTGAG
GenBank Accession BX897035 [GenBank]
Graphic View Graphic view of gene At3g17970
Predicted Position of Insertion Chr3:6150774 - go to primer design
BLAST e Value 1e-89
Hit Clone Code (BAC ID) MEB5
Hit Gene Code At3g17970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocon at the outer membrane of chloroplasts 64-III
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX897035 [GenBank]


Last Updated on 10.06.2021 13:37